GB/T 25876-2010Method of nested PCR for sex identification of early cattle embryo (English PDF)
牛早期胚胎性别的鉴定 巢式PCR法
Open the GB/T 25876-2010 preview as PDF
This is a limited preview
Buy now to download the full PDF (8 pages)
Issued by
General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China; Standardization Administration of China
Level / Type
National · Recommended
Issue date
January 10, 2011
Implementation date
June 1, 2011
Scope
GB/T 25876-2010 is the English-translated version of 牛早期胚胎性别的鉴定 巢式PCR法.
GB/T 25876-2010 is the Chinese national standard on method of nested pcr for sex identification of early cattle embryo, in the field of agriculture. The /T suffix marks it as a recommended standard: it is not compulsory by itself, but it becomes binding as soon as a contract, a tender or a customer specification calls it up - which in practice is how most foreign buyers meet it. It was issued on 10 January 2011 by the General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China; Standardization Administration of China, and has been in force since 1 June 2011. Classification: ICS 65.020.30, CCS B43. This page is published from the official record of the standard held by the Chinese standards administration: the identification, the dates, the classification and the issuing body are taken from there. The clause text, the tables and the numeric limits are in the document itself, which is delivered complete in English translation.
Document preview — GB/T 25876-2010
National Standard of the People's Republic of China
- ICS
- 65.020.30
- Classification
- B43
Issued by: General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China; Standardization Administration of China
Contents
- 1 Scope
- 2 Normative references
- 3 Terms and Definitions
- 3.3 HBB gene HBBgene beta-globin gene, located on chromosome often. Principle
Foreword
Appendix B of this standard is a normative appendix, Appendix A is an information appendix. The standard proposed by the People's Republic of China Ministry of Agriculture. This standard by the National Standardization Technical Committee of animal husbandry. This standard was drafted. Huazhong Agricultural University. The main drafters of this standard. - selection of Yang Liguo, Li Xiang, Liu Hui, Liu move, Huxiu Zhong. Bovine early embryo gender identification nested PCR
1 Scope
GB/T 25876-2010 is the Chinese national standard on method of nested pcr for sex identification of early cattle embryo, in the field of agriculture. The /T suffix marks it as a recommended standard: it is not compulsory by itself, but it becomes binding as soon as a contract, a tender or a customer specification calls it up - which in practice is how most foreign buyers meet it. It was issued on 10 January 2011 by the General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China; Standardization Administration of China, and has been in force since 1 June 2011. Classification: ICS 65.020.30, CCS B43. This page is published from the official record of the standard held by the Chinese standards administration: the identification, the dates, the classification and the issuing body are taken from there. The clause text, the tables and the numeric limits are in the document itself, which is delivered complete in English translation.
This standard specifies the nested PCR sexing of bovine early embryos. This standard applies to dairy and beef sexing embryo or fetus.
2 Normative references
The following documents contain provisions which, through reference in this standard and become the standard terms. For dated references, subsequent Amendments (not including errata content) or revisions do not apply to this standard, however, encourage the parties to the agreement are based on research Whether the latest versions of these documents. For undated reference documents, the latest versions apply to this standard. Laboratory use specifications and test methods GB/T 6682 Analysis
3 Terms and Definitions
The following terms and definitions apply to this standard.
3.1 Nested PCR nestedpolymerasechainreaction The use of two sets of PCR primers (nested PCR primer pairs) two rounds of PCR amplification reaction, in the first round of amplification, the outer primer for production Health amplification products, the presence of this product, including primers, DNA as a template, a second round of amplification.
3.2 SRY gene SRYgene Male sex genes determine mammalian Y chromosome.
3.3 HBB gene HBBgene beta-globin gene, located on chromosome often. Principle
4 The use of nested PCR reaction with high sensitivity and specificity of the characteristics of a small amount of SRY gene fragment was amplified embryonic cells to HBB gene was amplified as a positive reference, electrophoresis PCR products amplified product according to the electrophoretic bands embryo gender identification.
SRY1 5'CTACTCCCCAACCGTCAGAAC3 ' 5'AGCCCAAACCCATCAACCTA3 ' SRY2 5'CCAGGGAACTGCTTGGGTA3 ' 5'TGCTTCTCCACTTAGGCTCAA3 ' HBB 5'TATCCCACTTACAAGGCAGGTT3 '
......
This preview omits tables, figures, formulas and parts of the technical clauses. The complete document — 8 pages — is available in the English PDF.
Referenced standards
Normative references
Similar standards
GB 23238-2021|GB 4143-2022|GB/T 17824.2-2008|GB 20557-2006|GB/T 19374-2003
Editions of GB/T 25876
| Edition | Title | Revision | Status |
|---|---|---|---|
| GB/T 25876-2010 | Method of nested PCR for sex identification of early cattle embryo | current edition | Current |
This page sells the current edition, GB/T 25876-2010. Earlier editions are listed for reference only.
How to Buy GB/T 25876-2010
- 1Add to cart. Click the "Buy GB/T 25876-2010" button on this page. You can add more standards before checkout.
- 2Checkout. Enter your email and billing details. Payment is processed securely by Stripe (cards, Apple Pay, Google Pay supported).
- 3Instant delivery (0–9 sec). Delivery is automatic: within seconds of payment you'll receive an email with a secure download link. The link stays valid for 72 hours.
- 4Invoice included. A tax invoice is attached to the confirmation email. Need a custom invoice? Contact us.
Related Standards
GB/T 6682-2008 — Water for analytical laboratory use - Specification and test methods
GB/T 47310-2026 — Determination of total silicon, aluminium, iron, potassium, sodium, calcium, magnesium, manganese, phosphorus, titanium and sulfur in soil - Monochromatic excitation energy dispersive X-ray fluorescence spectrometry
GB/T 47321-2026 — Specification for the warning data exchange of the national emergency early warning dissemination system
Secure payment via Stripe
Payments accepted
GB/T 25876-2010
$110.00