SN/T 5109-2019Method for detection of Yersinia tyrosin polymerase spiral constant temperature amplification in border ports (English PDF)

7.1 Main instruments

The main equipment is as follows.

Fluorescence PCR instrument; or nucleic acid amplification instrument; or constant temperature amplification detection instrument; or metal bath; or water bath. 65 °C ± 1 °C; 95 °C ± 1 °C.

7.2 Main reagents

The main reagents used are as follows.

--- Multi-function sample processing solution. 5% Celex-100, 1% TritonX-100 TE buffer (Tris 10MM, EDTA) 1mm) (see Appendix A for specific preparation methods);

--- Rapid constant temperature amplification kit for Yersinia pestis. Including nucleic acid-free extraction reagents (multifunctional sample processing tube 1, containing multifunctional samples Product treatment solution), Yersinia pestis one-drop on-site detection kit 2 (see Appendix B for specific methods), Yersinia pestis real-time fluorescence PSR Test Kit 3 (see Appendix C for specific methods);

Note 1,2,3. Reagents 1, 2, and 3 are provided by the designated unit. This information is provided for the convenience of users of this standard and does not indicate approval of the product. in case Other equivalent products have the same effect, you can use these equivalent products.

--- Primer. A primer set designed based on the conserved sequence of the F1 gene of Yersinia pestis (GenBank number. X619.96.1) is composed as follows.

FP. AAGGTACCATTGGGATTCACCCCCCGCGCGCGCTATAAAAACAGGAAC BP. AAGTACATACTGGGATCACCCCCCGCCCACATACCTCTAGCTACTGCTCCTGATCA IF. GCATTCGTAGAAGTAGAAGTAGTCGC

--- dNTPs. four nucleotides, each at a concentration of 10 mm;

SN/T 5109-201919 ????? ????, ????, ??

--- Reaction buffer (RM). Tris-HCCl 20.0 mm, ammonium sulfate 10.0 mm, potassium chloride 10.0 mm, magnesium sulfate 8.0 mm, Tween- 20.1%, betaine 0.8M, dNTP (each) 1.4mm, primers FP, BP each 1.6µM, IF0.8µM, pH 8.8;

--- Color development solution. cresol red 2.0mm, phenol red 0.5mm. Or fluorescent dye. EverGreen (20 × aqueous solution). Choose either

--- Positive control. traceable identified strain, or DNA containing the target fragment.

8.1 Sample preparation

8.1.1 Environmental samples such as white powder and surface of objects

Wet a sterile cotton swab with sterile physiological saline or multi-functional sample treatment solution, soak white powder, or wipe the surface of the contaminated object.

In a test tube containing 2mL of multifunctional sample processing solution, the oil-based pen number is marked for inspection.

8.1.2 Samples of rodent organs

Tissues such as liver, spleen, lung, heart blood, and lymph nodes with suspicious pathological changes, which are collected by aseptic technique, are added in 4 to 8 drops (about 100 µL to 200 µL) grinding solution (normal saline or multi-functional sample processing solution) grinding. Use a sampling cotton swab to dip the ground homogenate (about 50 µL ~ 100µL), placed in a test tube containing 2mL of multi-functional sample processing solution, oily pen number marked for inspection.

8.1.3 Flea samples

After the species are identified, they are grouped by collection time, place, and type, and 10 to 20 are a group of samples to be tested. Sample to be added 4 to 8 drops (about 100 µL to.200 µL) of grinding liquid (physiological saline or multifunctional sample processing solution) are ground. Use a sampling cotton swab to dip the ground homogenate (about 50 µL to 100 µL) and place it in a test tube containing 2 mL of multifunctional sample processing solution. The oily pen number is marked for inspection.

8.1.4 Human samples

May include human venous blood, lymph fluid, bloody sputum, bloody stools, pharyngeal secretions, eye secretions, blisters/pustules, cerebrospinal fluid, ulcers and wounds under the skin. Aseptically collected venous blood from 3 to 5 mL of the subject, and allowed to stand at room temperature for several minutes to coagulate the blood. The upper layer is serum. Sampling cotton, swabs, bloody sputum, secretions, or solid excreta with a sampling cotton swab, and place it in a 2mL multifunctional sample treatment solution in the test tube, the number of oily pen is marked for inspection.

8.2 PSR detection of Yersinia pestis

8.2.1 Sample processing and template preparation

Place the sampling cotton swab in a test tube containing 2mL of multi-functional sample processing solution, shake and mix, and then place it in a thermostatic amplification detector (or metal Bath, water bath pot), heated at 95 ° C for 10 minutes. After taking out to room temperature, it can be used as a sample DNA template.

8.2.2 PSR reaction system and loading

Yersinia pestis PSR reaction results can be determined using the chromogenic method or the fluorescent dye method. The reaction system and the amount of sample See Tables 1 and 2. Set positive and negative control tests.

SN/T 5109-201919 ????? ????, ????, ??

Table 1 Yersinia pestis PSR reaction system (chromogenic method)

Component working solution concentration reaction system final concentration loading amount (25µL system) 2 × RMBuffer 2 × 1 × 12.5µL dNTPs 10mm 1.4mm 3.5µL Primer FP, BP mixed solution 50µM 80pM 1.6µL Primer IF solution 50µM 40pM 0.8µL Cresol Red 2.0mm 0.08mm Phenol red 0.5mm 0.02mm 1.0µL Template DNA/Negative Control/Positive Control 3.6 µL

Table 2 Yersinia pestis PSR reaction system (fluorescent dye method)

Component working solution concentration reaction system final concentration loading amount (25µL system) 2 × RMBuffer 2 × 1 × 12.5µL dNTPs 10mm 1.4mm 3.5µL Primer FP, BP mixed solution 50µM 80pM 1.6µL Primer IF solution 50µM 40pM 0.8µL EverGreen 20 × 0.8 × 1.0 µL Template DNA/Negative Control/Positive Control 3.6 µL

8.2.3 Amplification

Chromogenic method. Place the reaction tube in a nucleic acid amplification instrument (or thermostatic amplification detector, metal bath, water bath, heating module), and perform a constant temperature reaction at 65 °C 40min.

Fluorescent dye method. Place the reaction tube in a fluorescence quantitative PCR instrument. The program settings are shown in Table 3.

Table 3 Yersinia pestis fluorescent PSR reaction procedure

Phase cycle temperature time content fluorescence acquisition PSR reaction 40 65 °C 60s extension is Dissolution curve analysis

8.2.4 Quality control

8.2.4.1 The effective test of the chromogenic method shall meet the following conditions.

--- The color of the negative control is still pink;

SN/T 5109-201919 ????? ????, ????, ??

--- The color of the positive control turns yellow.

8.2.4.2 Effective experiments of the fluorescent dye method shall meet the following conditions.

--- Positive control appeared S-type amplification curve in the reaction stage, and the dissolution curve was a single peak;

--- Negative control has no amplification curve in the reaction stage, and no peak appears in the dissolution curve.

8.2.5 Determination of results

8.2.5.1 Chromogenic method, observe the results after the reaction tube is cooled to room temperature, and judge the results according to the following conditions.

--- Positive result. The liquid in the reaction tube of the sample to be tested is yellow, which indicates that the Yersinia pestis nucleic acid has been detected. The test result of this sample is preliminary screening.

Positive

--- Negative result. The liquid in the reaction tube of the sample to be tested is pink, indicating that no Yersinia pestis nucleic acid has been detected, and a rapid test result can be reported.

Fruit negative.

8.2.5.2 The fluorescent dye method is used to determine the results according to the following conditions.

--- Positive results. S-type amplification curve appears in the reaction stage of the sample, and the dissolution curve is a single peak, and it has a single peak position with the positive control Close (Tm range is within 1 ° C)

--- Negative result. There is no amplification curve and no peak of dissolution curve appears in the sample during the reaction stage.

8.2.5.3 Polymerase spiral thermostated amplification test method Initial screening of positive samples should be confirmed by other detection methods.

SN/T 5109-201919 ????? ????, ????, ??

Appendix A

(Informative appendix) Solution preparation A. 1 Preparation of comprehensive sample treatment solution Take 5.0g of Cellex-100 (Bio-rad) and 1.0mL of TritonX-100 in 100mL of TE buffer (Tris10MM, EDTA1mm) was prepared into a Celex lysate, which is the sample comprehensive treatment solution. Can be stored for one year.

Take 2.64g of ammonium sulfate, 1.49g of potassium chloride, 3.95g of magnesium sulfate heptahydrate, 2.0mL of Tween-20 in a 100mL volumetric flask, and fully dissolve.

Solution, adjust pH to 8.0 with 1% KOH solution, make up to 100mL, and store at 4 ° C for one year.

Take 7.5g betaine in a 20mL volumetric flask, fully dissolve and make up to 20mL, store at 4 ° C, and store for one year.

A. 2.3 Preparation of solution 2 × RM the reaction mixture of PSR should avoid repeated freezing and thawing, so it is generally formulated into a small system of 2mL. Pipette.200 µL of 20 × RMpre into a 2 mL centrifuge tube, add 53.33 µL of Tris-HC1 solution (1.5 M, pH 8.8), 1.0 mL of betaine solution (0.375 g/mL), and add 746.67 µL to remove Make up to 2mL of ionized water, store at -20 ° C, and store for one year.

A. 3 Preparation of primer mixture the synthesized upstream and downstream primer powders were diluted to 50 µM with pure water, and the two primers were mixed in equal volume and recorded as PM (PrimerMix, primer mixture).

A. 4 Preparation of color developing solution Weigh 0.0765g of cresol red (Sigma, USA) and 0.0177g of phenol red (Sigma, USA) and dissolve in 100mL of pure water.

The molar concentrations of cresol red and phenol red are 2.0 mm and 0.5 mm, respectively. Can be stored for one year. When in use, take 1 µL of this color development solution in 25 µL PSR reaction system.

SN/T 5109-201919 ????? ????, ????, ??

Appendix B

(Informative appendix) Reference to the Yarrow Plasma Helical Constant Temperature Amplification One Drop Method B. 1 Sample processing B. 1.1 Environmental samples such as white powder and object surfaces Wet a sterile sampling cotton swab with sterile physiological saline or multi-functional sample treatment solution, soak white powder, or wipe the surface of the contaminated object.

In the multifunctional sample processing tube, the oil-based pen number is marked for inspection.

B. 1.2 Human samples may include venous blood, lymph fluid, bloody sputum, bloody stools, pharyngeal secretions, eye secretions, vesicular/vesicular fluid, cerebrospinal fluid, ulcerative surface and the secretions under the skin.

Aseptically collected venous blood from 3 to 5 mL of the suspected infection, left at room temperature for several minutes to coagulate the blood, and the upper layer was serum. Sampling cotton Stained with serum or lymph fluid or bloody sputum, secretions or solid excreta, placed in a multifunctional sample processing tube.

After the sample processing tube is capped tightly, the oily pen number is marked. Try to detect immediately.

B. 1.3 Flea samples

After the species are identified, they are grouped by collection time, place, and type, and 10 to 20 are a group of samples to be tested. Sample to be added 4 to 8 drops (about 100 µL to.200 µL) of grinding solution (sterile physiological saline or multifunctional sample processing solution) are ground. Use a sampling cotton swab to dip and grind the homogenized slurry (about 50 µL to 100 µL), place it in a multifunctional sample processing tube, mix it, and place it in the lysis zone of a smart constant temperature detector. Click the heating lysis button, remove it after 10 minutes and wait for inspection.

B. (2) Yersinia pestis one-drop PSR isothermal field test B. 2.1 Sampling and positive and negative control tests B. 2.1.1 Positive and negative control tests Take out Yersinia pestis PSR constant temperature field test kit, and open the positive (yellow tube) and negative control tube (blue tube) respectively.

The multifunctional sample processing tube squeezes out the clean lysate, add 2 drops to the positive and negative tube caps.

The liquid turns red, then the tube cap is closed and inverted for inspection.

B. 2.1.2 Sample detection After processing the sample, open the test tube (pink) and add 2 drops of the sample template processed by the multi-function sample processing tube to the test.

Tube cap, after adding 2 drops of lysing solution, the tube cap liquid turns pink, and the tube cap is fastened and inverted for about 10s.

Pick up the reaction tube, positive control tube, and negative control tube, and shake the liquid on the tube cover into the reaction tube.

B. 2.2 Amplification reaction Place the reaction tube in the intelligent constant temperature detector, click the amplification button, and see that the blocking agent melts after 2 min. Take out the reaction tube and shake it quickly twice.

Allow the reaction solution to mix thoroughly. You will observe the red droplets mixed with the reaction solution at the bottom, and then place it in the thermostat.

take out.

SN/T 5109-201919 ????? ????, ????, ??

Do not open the lid during the reaction.

B. 2.3 Observation and analysis of results Allow the reaction tube to cool to room temperature and observe with the naked eye. The color of the negative control tube is pink, and the color of the positive control tube becomes yellow the test tube turns yellow to indicate the presence of Yersinia pestis gene (positive) in the test sample; the color of the test tube is pink, which indicates the sample to be tested the Yersinia pestis gene is not present (negative).

Positive samples with constant temperature field results can be further confirmed by other corresponding methods.

SN/T 5109-201919 ????? ????, ????, ??

Appendix C

(Informative appendix) refer to the Yersinia pestle spiral thermostatic rapid detection kit (real-time fluorescence PSR method) C. 1 Sample processing Environmental samples. cotton swabs are mixed with powder in a multi-functional sample processing tube and mixed thoroughly;

Animal material. grind with a grinding pestle, take a cotton swab, take the homogenate and transfer it to a multifunctional sample processing tube, and mix thoroughly;

Bacteria. Cotton swabs are used to absorb bacterial colonies or bacterial suspensions in multifunctional sample processing tubes and mix thoroughly.

C. 2 template preparation the multifunctional sample processing tube to be reacted is placed in the lysis zone of the intelligent constant temperature detector, and the heating lysis button is clicked;

Remove at 95 ° C after pyrolysis for 10 min. Transfer the supernatant to a new centrifuge tube and store at 4 ° C or -20 ° C for testing, or use it directly in PSR Amplification.

C. 3 Real-time fluorescent PSR detection of Yersinia pestis C. 3.1 Establishing the Real-TimePSR reaction system, see Table C. 1.

Ingredients added

Reaction solution (2X) 12.5 µL Sample size/positive control 2µL ~ 10µL Make up to 25µL with ultrapure water Add the above components to the tube cap, leave it for 30s to 60s to fully dissolve the tube cap vitrified, and then shake all the liquid to the bottom of the tube, and open the tube Add 1 drop of blocking solution to the cap, cap the tube, and centrifuge briefly.

C. 3.2 Establishing a Real-TimePSR reaction program, see Table C. 2.

Phase cycle temperature time content fluorescence acquisition PSR reaction 60 65 °C 60s extension is Dissolution curve analysis Place the reaction tube in the fluorescence quantitative PCR instrument to start the reaction.

C. 4 result judgment the positive reaction was. S-type amplification curve appeared in the reaction stage, and the dissolution curve was a single peak;

SN/T 5109-201919 ????? ????, ????, ??

The negative reaction was as follows. no amplification curve and no peak of the dissolution curve appeared in the reaction stage.

Criteria for positive and negative results. Positive reactions begin to appear in the positive control in about 30 minutes, and no negative control in 60 minutes in the case of changes, the S-type amplification curve appears in the sample at the reaction stage, and the dissolution curve is a single peak, which is connected to the single peak position of the positive control.

Near (Tm range is within 1 ° C), the sample can be judged positive at this time. No amplification curve and no dissolution curve for the sample during the reaction phase A peak appears to be negative.

If a negative reaction occurs in the positive control or a negative reaction occurs in the negative control, the experiment should be repeated.

SN/T 5109-201919 ????? ????, ????, ??