SN/T 5107-2019Method for detecting multi-pathogen gene suspension chip of mosquito-borne infectious diseases at entry and exit ports (English PDF)

6.1 Sample collection

6.1.1 Collect blood from people in the epidemic area, suspicious entry-exit personnel, and applicants for inspection.

6.1.2 Collect samples of mosquitoes or other means of mosquitoes concealed from vehicles or transportation equipment from infected areas.

6.2 Submission and processing of samples

6.2.1 Mosquito samples. Put the collected mosquitoes directly into the -20 °C refrigerator to freeze to death, take them out, sort them by number, and pack 30 ml into 2ml Inside the screw mouth plastic tube, transport or store at -70 ° C for inspection.

6.2.2 Serum and plasma. Absorb directly into a sterile centrifuge tube with a sterile syringe for processing, and number it for future use.

7.1 Major equipment

Suspension chip system, fluorescence microscope, level electrophoresis system, gel imaging system, centrifuge, PCR instrument, biological safety cabinet, pipette, nuclear Acid protein detector, vacuum pump, vortex shaker.

7.2 Main reagents

MEM and Hank's solution, specimen treatment solution (see A.1 in Appendix A), PCR reaction solution (see A.2 in Appendix A), tetramethylammonium chloride (TMAC), 1.5 × TMAC hybridization solution (see A.3 in Appendix A), 1 × TMAC hybridization solution (see A.4 in Appendix A), carboxylation Code microspheres (BioRad), 2 [N-morpholine] ethanesulfonic acid (MES) (pH 4.5), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride Salt (EDC), SDS, N-dodecyl sarcosinate, TE (pH 8.0) (see Appendix A.5), streptavidin-phycoerythrin (SA-PE), beta Diamine tetraacetic acid (EDTA), 75% ethanol, Trizol, chloroform, Tween-20, random primers, AMV reverse transcription kit, 20% chelation Resin Cherex100.

8.1 DNA extraction

8.1.1 Method for extracting Plasmodium DNA from blood sample

8.1.1.1 Take 20µL of whole blood and place it in a 1.5mL centrifuge tube.

8.1.1.2 Add.200 µL preheated 5% Celex 100, heat at 100 ° C for 10 minutes, and shake 3 to 5 times during this period.

8.1.1.3 Centrifuge at 12,000 g for 3 min. Take the supernatant to a clean 0.5 mL centrifuge tube and store at 4 ° C or -20 ° C until use.

8.1.2 Method for extracting Plasmodium DNA from mosquito samples

8.1.2.1 Grind the mosquito samples to be inspected in a tissue grinder or homogenize in an electric homogenizer for 20s to 30s to homogenize the samples into a paste.

Centrifuge at 2,000 g for 3 min, and take the supernatant as a sample.

8.1.2.2 Add 150 µL of re-distilled water and 50 µL of 20% Cellex 100 and heat for 10 min at 95 ° C to extract DNA.

8.1.2.3 During the heating process, vortex every 2 min.

8.1.2.4 Centrifuge the mixture at 2,000 g for 3 min. Take the supernatant into a clean 0.5 mL centrifuge tube and store at 4 ° C or -20 ° C.

spare.

SN/T 5107-201919 ????? ????, ????, ??

8.2 RNA extraction

8.2.1 Remove the mosquito sample to be tested from the container at -70 ° C, operate on ice, pour it into the grinder, and add 1 mL of Hank's solution to rinse it.

After discarding the liquid, add 1 mL of the sample treatment solution, and repeatedly grind until the tissue fragments have basically disappeared, and then suck the abrasive liquid into 1.5 mL Eppendorf centrifuge tube, equilibrated and centrifuged at 4 ° C and centrifuged at.2000g for 10 min. Take the supernatant for nucleic acid extraction, the rest the mosquito specimen grinding fluid should be stored in a refrigerator at -70 ° C for review.

8.2.2 Take a sterilized 1.5mL centrifuge tube, add 1mL of lysate Trizol, and then add the tested samples after 8.2.1 treatment.

300 µL, and then add.200 µL of chloroform, and fully oscillate evenly (such as using a vortex shaker to avoid excessively strong emulsification). Centrifuge at 12,000 g for 15 min at 4 ° C.

8.2.3 Transfer 500 µL of the supernatant of the sample after centrifugation to a new 1.5 mL sterilized centrifuge tube. Add 400 µL of pre-chilled isopropanol to avoid sucking into the middle layer. Close the bottle cap and invert Mixed. -The refrigerator at 20 ° C is left to stand for 30 minutes.

8.2.4 Centrifuge at 2,000 g for 15 min. Gently pour off the supernatant. Add 500 µL of 75% ethanol to each tube and wash by inversion. 8.2.5 Centrifuge at 12,000 g for 10 min. Gently pour off the supernatant, aspirate the remaining liquid, and dry at room temperature for 5 min.

8.2.6 Dissolve the extracted RNA in 20 µL DEPC water until use.

8.3 PCR amplification

8.3.1 Synthesis of DNA by reverse transcription

Using random primers as reverse transcription primers, select commercial reverse transcription kits, follow the instructions of the reagents, and use viral RNA as a template Synthesis of cDNA.

8.3.2 Multiplex PCR amplification

8.3.2.1 Selection of multiple PCR amplification primers. For the design method of amplification primers, see Appendix B, Table B. 1. cDNA synthesized with random primers is template.

8.3.2.2 The PCR reaction system of West Nile virus is shown in Table 1.

Table 1

System component dosage (µL) 10 × PCR Buffer 2µL dNTP (2.5 mmol/L) 2 µL goldTa enzyme (5U/µL) 0.07µL WNV-F (5µM) 0.3µL WNV-R (5 µM) 1.5 µL Sample reverse transcription product cDNA 1 µL ddH2O 13.13µL 20 µL final volume PCR reaction program. 94 ° C 5 min; 94 ° C 30, 56 ° C 30s, 72 ° C 30s, 40 cycles; 72 ° C 10min; 10 ° C Insulation.

8.3.2.3 The multiple PCR reaction systems for yellow fever virus, dengue virus type I and dengue virus type IV are shown in Table 2.

SN/T 5107-201919 ????? ????, ????, ??

Table 2

System component dosage (µL) 10 × PCR Buffer 2µL dNTP (2.5 mmol/L) 2 µL goldTa enzyme (5U/µL) 0.07µL QFV-F (5µM) 0.3µL QFV-R (5 µM) 1.5 µL DENVI-F (5µM) 0.3µL DENVI-R (5µM) 1.5µL DENV IV-F (5 µM) 0.3 µL DENV IV-R (5 µM) 1.5 µL Sample reverse transcription product cDNA 1 µL ddH2O 9.53 µL 20 µL final volume PCR reaction program. 94 °C 5min; 94 °C 30s, 56 °C 30s, 72 °C 30s, 40 cycles; 72 °C 10min; 10 °C Insulation.

8.3.2.4 Chikungunya virus, Japanese encephalitis virus, Dengue virus type II, Dengue virus type III, Plasmodium multiple PCR reaction system see

Table 3.

Table 3

System component dosage (µL) 10 × PCR Buffer 2µL dNTP (2.5 mmol/L) 2 µL goldTa enzyme (5U/µL) 0.07µL CHIKV-F (5µM) 0.3µL CHIKV-R (5 µM) 1.5 µL JEV-F (5 µM) 0.3 µL JEV-R (5 µM) 1.5 µL DENVII-F (5µM) 0.3µL DENVII-R (5µM) 1.5µL DENVIII-F (5µM) 0.3µL DENVIII-R (5µM) 1.5µL PU-F (5µM) 0.3µL PU-R (5 µM) 1.5 µL 1 µL each of the sample reverse transcription product cDNA and genomic DNA ddH2O 4.93 µL 20 µL final volume PCR reaction program. 94 °C 5min; 94 °C 30s, 60 °C 30s, 72 °C 30s, 40 cycles; 72 °C 10min; 10 °C SN/T 5107-201919 ????? ????, ????, ??

Insulation.

8.3.2.5 Selection of negative control and positive control. At the same time, the background control should be set to replace the sample template DNA and RNA with water; the negative control should be RNA and DNA of non-target pathogens serve as templates for PCR reactions; positive controls use DNA containing detection sequences as PCR responses Application template DNA.

8.4 Coupling of probes with carboxylated microspheres

8.4.1 Probes (see Table B.2 for sequence) are connected to 20 polly (T) at the 5 'end of the probe. The concentration was 10 mmol/L.

8.4.2 The carboxylated coded microspheres in a 1mL package were oscillated for 30 s and sonicated for 30 s to break the microspheres.

8.4.3 Take a 100 µL pellet into a 1.5 ml LEP tube, centrifuge at 4,000 g for 4 min, and carefully aspirate the supernatant. 8.4.4 The microspheres were resuspended in 0.1 mol/LMES at 50 µL pH 4.5, oscillating for 20 s, and sonicating for 20 s. 8.4.5 Dilute the 10 mol/L oligonucleotide probe 10-fold with distilled water, add 2 µL of the 10-fold diluted probe to the microsphere suspension, and mix by shaking.

8.4.6 Add 2.5 µL of a freshly prepared 10 mg/mL EDC solution to each 1.5 mL LEP tube, and shake to mix. Place on a vortex shaker and incubate for 30 min at room temperature in the dark.

8.4.7 Add 2.5 µL of freshly prepared EDC solution and shake to mix. Place the vortex shaker again and incubate for 30 min at room temperature in the dark. 8.4.8 After the reaction, centrifuge at 4,000 g for 4 min, and carefully discard the supernatant.

8.4.9 Add 1 mL 0.02% Tween-20 to each 1.5 mL LP tube, and shake to mix. Centrifuge at 4,000 g for 4 min.

Supernatant.

8.4.10 Add 1 ml 0.1% SDS to each 1.5 ml LP tube, shake and mix, centrifuge at 4,000 g for 4 min, and aspirate and discard the supernatant. to Add 100 µL of pH 8.0 TE to a 1.5 ml LP tube, shake for 10 s, and sonicate for 10 s to resuspend the microspheres. 8.4.11 Counting of microspheres. Count with a blood cell counting board. Aspirate an appropriate amount of microspheres, and after dilution, use a blood cell counting plate (0.10 mm;

1/400mm2) Count under ordinary light microscope. The calculation formula is shown in formula (1), and the microsphere concentration is recorded.

Number of microspheres = number of each large cell × 104 × dilution factor × volume (mL) (1)

8.4.12 After counting with a blood cell counting plate, the microsphere stock solution is stored at 4 ° C for future use.

8.5 Crossing

8.5.1 Approximately 3500 to 5,000 probe-coupled microspheres were each mixed in 33 µL of 1.5 × TMAC hybridization solution and placed in 0.2 µL centrifuge tubes.

8.5.2 Add 5 µL to 17 µL of the PCR amplification product in 8.3 to each tube to make the final volume 50 µL, and mix by pipetting. 8.5.3 At the same time, add 5 µL to 17 µL TE to a tube to make the final volume 50 µL, pipette and mix well. The test result is used as the fluorescence value of the blank control.

8.5.4 Denaturation at 95 ° C for 10 min. Hybridize for 30 min at 55 ° C. Transfer to a filter plate and suction to remove unbound PCR product.

8.5.5 Add 75 µL 4ng/µL SA-PE 1 × TMAC solution to each well, and incubate for 10 min at room temperature in the dark, and remove unbound SA-PE by suction filtration.

8.5.6 Add 75 µL of 1 × TMAC solution to each well and shake to resuspend the microspheres.

8.6 Determination of fluorescence value

Put the filter plate in the suspended chip detection instrument to measure the fluorescence value.

8.7 Determination of results

8.7.1 Quality control

The reaction results should meet the following four conditions at the same time, otherwise the experimental results are invalid.

SN/T 5107-201919 ????? ????, ????, ??

--- The fluorescence value of the background control should be close to the fluorescence value of the blank control;

--- The fluorescence value for the quality control of the connected probe microspheres should be much greater than the fluorescence value of the blank control (more than 10 times);

--- Negative quality control is the negative control during PCR amplification, and the detection fluorescence value should be close to the background fluorescence value;

--- Positive quality control is the positive control during PCR amplification, and the detected fluorescence value should be much larger than the negative quality control fluorescence value.

8.7.2 Determination of results

8.7.2.1 Take the negative control test reading of each virus-specific nucleic acid probe as the background value.

8.7.2.2 For dengue viruses (DENV I, DENV II, DENV III, DENV IV), for each virus-specific nucleic acid probe, If its sample detection reading/background value is >=2, then it is determined that the virus test result of this sample is positive; if its sample detection reading/background value is 9 Notes

9.1 All items (such as cotton swabs, test strips, gloves, straws, etc.) that have come into contact with or may come into contact with suspected pollutants during the test should be completely eliminated.

Poison treatment.

9.2 The positive samples after testing shall be sent to the relevant laboratory for further testing and identification. The inspection of samples shall be carried out in accordance with Sn/T 2878.

SN/T 5107-201919 ????? ????, ????, ??

Appendix A

(Normative appendix) Solution preparation A. 1 specimen processing solution Add 95mL of fetal bovine serum (2mL, 1mL of gentamicin) to freshly prepared 95mL of MEM and heat inactivate 30min at 56 ° C.

(5,000 µg/mL), 1 mL of amphotericin B (250 µg/mL), and 1 mL of penicillin (penicillin G1000U/mL, streptomycin 1000 µg/mL), adjusted to pH 7.2 with a 7.5% sodium bicarbonate solution...

A. 2 PCR reaction solution 10 × PCR buffer, dNTPs (2.5 mmol/L), goldTazyme (5U/µl).

A. 3 1.5 × TMAC hybridization solution 4.5mol/LTMAC, 0.15% sodium N-dodecylsarcosine, 75mol/LTris-HC1 pH8.0, 0.6mol/LED-TAPH8.0.

A. 4 1 × TMAC hybridization solution 3mol/LTMAC, 0.1% sodium N-dodecylsarcosine, 50mol/LTris-HC1 pH8.0, 0.4 mmol/LEDA pH 8.0.

A. 5 TE buffer

10mmol/Ltris-CLPH7.5, 1mmol/LEDApH8.0.

SN/T 5107-201919 ????? ????, ????, ??

Appendix B

(Normative appendix) Primers and probes

Table B. 1 Primer pair sequences for PCR amplification

Virus name Primer name Nucleotide sequence (5'-3 ') Amplified length Yellow fever virus FFV-FQFV-R ACCGCGCGCAATCAAATAAA Biotin-GTTGGTGTCCCCCTCACATCA 88 Chikungunya virus CHIKV-FCHIKV-R ACCCTCCGCAGAGCGACCACA Biotin-GCTGCACACGAGCGACACCC 133 West Nile virus WNV-FWNV-R GATGTGGAGACGCTCGGTAG Biotin-GAGTCTTGGAAAACCGGAACCG 120 Japanese encephalitis virus JEV-FJEV-R GCACACGCGGTGGAGAAACA Biotin-CCAAGAGCACACACGAGCT 79 Dengue virus type DENVI-FDENVI-R GAGGTCACAGCCACATCG Biotin-TGTTGTGTCCCAAAAGGTGTGT 128 Dengue virus type DENVII-FDENVII-R AAAAGAACCACCGAGTGATTGC Biotin-CCTACATATCTCTCACACGCCCTCA 128 Dengue virus type III DENVIII-FDENVIII-R GACGCGGGATTAGGACTCTAG Biotin-TGGCGGTTGGTAGGTACTATC 108 Dengue virus type IV DV-FDENV IV-R AGTATCAAGAGGGTTCCCAGTGAG Biotin-TGTAGTTGCGCGCATAGTAGAAG 122 Plasmodium PU-FFU-R TGTGTTGCGAGGTTAAAAACGCGCTCG Biotin-GCTTGTGAACACCTCTATCTATTCTC 245

Table B. 2 Probe sequences for detecting pathogens

Virus name Probe name Nucleotide sequence (5'-3 ') Microsphere number Yellow fever virus FFV-P NH2-- (CH2) 12-CCCATCGCGCTCACACACAT 22 Chikungunya virus CHIKV-P NH2- (CH2) 12-TCCCAGGACATTCTCCCGCTAG 39 West Nile virus WNV-P NH2- (CH2) 12-TACCCCCGAGAGCGCCCACA 15 Japanese encephalitis virus JEV-P NH2- (CH2) 12-GAGGCGCGCGCGCACACAAA 12 Dengue virus type I DENVI-P NH2- (CH2) 12-AATAGCCCATGTGACTACCC 18 Dengue virus type II DV-P NH2- (CH2) 12-GGGCGCCCATATCTCATGTAGTG 30 Dengue virus type III DVIII-P NH2- (CH2) 12-GGAAAAGGCTCACGCCCCAAA 36 Dengue virus type IV DV-P NH2- (CH2) 12-CATAGTGATTGTTGAGAGAG 42 SN/T 5107-201919 ????? ????, ????, ??

Table B. 2 (continued)

Virus name Probe name Nucleotide sequence (5'-3 ') Microsphere number Plasmodium vivax PV-P NH2- (CH2) 12-GCACACGGTCTCTAGGTATAT 45 Plasmodium falciparum PM-P NH2- (CH2) 12-CGTTTAGAGAATACAGCCGCACA 49 Plasmodium ovata PO-P NH2- (CH2) 12-GATGGTCTAGAGACATACACACG 56 Plasmodium falciparum PF-P NH2- (CH2) 12-CTAGGGGGACACTATTTGTAGCT 52 SN/T 5107-201919 ????? ????, ????, ??