SN/T 5096-2019Real-time fluorescent RT-PCR detection method for rumored lone star virus in border ports (English PDF)

6.1 Biosafety requirements

According to the requirements of GB 19489 and the "List of Pathogens of Human Infections", the biological safety requirements of solitary virus related materials are as follows.

-Handling of uncultured solitary virus infectious materials should be performed in a Biosafety Level 2 (BSL-2) laboratory;

-Lone star virus-related inactivated and non-infectious materials can be handled in a Biosafety Level 1 (BSL-1) laboratory-Lone star virus infectious material is transported and packaged in Category B, UN number UN 3373.

6.2 PCR anti-contamination requirements

PCR anti-contamination measures are implemented in accordance with WS/T 230.

8.1 DEPC water

DEPC-treated RNase-free water.

8.2 RNA extraction kit

QIAamp Viral RNA kit, see the kit manual for details, including AVL, AW1, AW2, and AVE, etc. 1). a

8.3 One-Step Fluorescent RT-PCR Kit

Ag-Path-IDTM One step RT-PCR Kit2). b

1) This information is provided for the convenience of users of this standard and does not indicate endorsement of the product. If other equivalent products have the same effect, these equivalent products can be used.

2) This information is provided for the convenience of users of this standard and does not indicate endorsement of the product. If other equivalent products have the same effect, these equivalent products can be used.

Lone Star Virus.indd 2.2019/9/12 14.00.53 ????? ????, ????, ??

8.4 Primers and probes

The sequence is shown in Table 1.

Table 1 Primer and probe sequences

Primer/Probe Name Sequence (5'-3 ') Monitoring Period F CTTCCTTAACCCTCAGATA 134 bpR CCTCTTTATGGTCCCTTA Probe FAM- TCATCAACATCTCGTCTCATTCGCT -BHQ1 Note. The 5 'end of the probe is labeled with the FAM fluorescent reporter and the 3' end is labeled with the BHQ1 fluorescent quenching group. Other equivalent fluorescent markers and Quenching groups or equivalent primers and probes or other equivalent commercially available detection kits can also be used.

9.1 Sample collection

9.1.1 Collection of tick samples

According to SN/T 1293.

9.1.2 Collection of human serum samples

3 mL ~ 5 mL of internal venous blood was collected aseptically within 3 days of the onset of the suspected case, and allowed to stand at room temperature for 30 minutes to coagulate, 1 500 r/min ~ 3 000 r/min Centrifuge for 10 minutes, collect the serum in a 2 mL sterile screw-top plastic tube, register it with a low temperature resistant oily marker, and send it to the laboratory at low temperature.

Detection. If it cannot be delivered to the laboratory within 24 hours, the serum should be stored in a refrigerator at -70 ° C.

9.2 Laboratory inspection

9.2.1 Sample processing

9.2.1.1 Tick samples

On the sterile operation platform, take out the ticks and place them in sterile dishes, soak them in 75% alcohol for 20 minutes, and blot them with sterile filter paper.

Alcohol on the surface, rinse 3 times with normal saline, blot dry the surface of the tick with sterile filter paper, pour into the mill, add 1 mL of PBS or wash with normal saline, discard the liquid, add 1 mL of PBS or normal saline, and repeatedly grind until the tissue fragments have basically disappeared, and then the grinding solution was sucked into a 1.5 mL centrifuge tube, pre-cooled at 4 °C in a centrifuge at 20 000 r/min, and centrifuged for 10 minutes.

Toxic nucleic acid extraction.

9.2.1.2 Serum samples

Serum samples are directly extracted from molecular biological nucleic acids. If they cannot be detected in a timely manner within 24 hours, they should be stored in a -70 ° C refrigerator.

9.2.2 Viral nucleic acid extraction

Refer to the commercial kit instructions, see Appendix A.

Lone Star Virus.indd 3.2019/9/12 14.00.53 ????? ????, ????, ??

9.2.3 Real-time fluorescent RT-PCR detection

9.2.3.1 Primers and probes

Primer and probe application solutions were formulated at a concentration of 10 µmol/L, and the amplified fragment size was 134 bp. The 5 'and 3' ends of the probe are FAM and BHQ1 tags.

9.2.3.2 Positive control and blank control settings

During the test, a positive control and a blank control were set. The positive control is part of the nucleotide sequence of the cloned lone virus (should include Contains amplified region) cDNA synthesized in vitro; blank control uses sterile double distilled water.

9.2.3.3 Reaction system composition

See Table 2.

Table 2 Reaction system of real-time fluorescent RT-PCR of lone virus

Unit is microliter (µL) Component volume DEPC water 4.5 2 × RT-PCR buffer 12.5 10 µmol/L upstream primer 1 10 µmol/L downstream primer 1 10 µmol/L probe 0.5 Enzyme mixture 0.5 Template RNA/negative control/positive control 5 Note. The total reaction system of real-time fluorescence RT-PCR of lone virus is 25 µL.

9.2.3.4 Reaction conditions

The one-step real-time fluorescent RT-PCR detection amplification conditions are. 45 °C for 10 min once; 95 °C for 10 min once; 95 °C for 15 s.

60 °C for 45 s, a total of 40 cycles. A fluorescence signal is collected at the end of each cycle. Select the FAM channel to collect the fluorescence signal when annealing at 60 °C;

Set the ROX channel as the reference channel. Different laboratories can make appropriate adjustments based on the reagents and instruments used with reference to the above reaction conditions.

9.2.4 Inspection result judgment and report

9.2.4.1 Threshold determination

The threshold determination method is uniform for all samples. Generally, the first 3 to 15 cycles of real-time the optical signal is used as the fluorescence background signal, and 10 times the standard deviation of the background signal is used as the fluorescence threshold.

The number of cycles when the fluorescence threshold is reached is the cycle threshold (Ct value).

9.2.4.2 Quality control

The reaction result should meet the following two conditions at the same time.

-No amplification curve appears for the negative control;

-The positive control has a Ct value <= 35 and a significant amplification curve.

Lone Star Virus.indd 4.2019/9/12 14.00.53 ????? ????, ????, ??

9.2.4.3 Judgment and Report of Results

When the results of the simultaneous positive control and blank control tests are normal, the test results of this method are determined and reported as follows.

-The test sample has a clear fluorescence amplification curve, and when the Ct value is <= 35, it is judged as positive, and the report "specificity of lone virus detection" Genes (Real-time fluorescent RT-PCR). "-When the Ct value of the fluorescence amplification curve of the test sample is between 35 and 40, it is recommended to perform a real-time fluorescence RT-PCR test again.

If the retested Ct value is still between 35 and 40, and the curve has a significant logarithmic growth period, it is judged to be positive, and the report "Lone star detected Virus-specific genes (real-time fluorescent RT-PCR) ", such samples are recommended to be further verified by other methods; otherwise it is negative the report "No lone virus specific gene was detected (real-time fluorescent RT-PCR method)".

-The test sample was negative for fluorescence amplification and was judged negative, and reported "No lone virus-specific gene (real-time fluorescence RT-PCR method). " Lone Star Virus.indd 5.2019/9/12 14.00.53 ????? ????, ????, ??

Appendix A

(Informative appendix) RNA virus nucleic acid extraction A.1 Take 140 µL of tick sample grinding solution or cell culture supernatant, add 560 µL of Lysis Solution (AVL), and shake on a vortex mixer Mix for 15 s and let stand at room temperature for 10 min.

A.2 Add 560 µL of absolute ethanol to stop the reaction, and shake on a vortex mixer for 15 s to mix.

A.3 The lysed liquid is transferred into the column twice and centrifuged at 8 000 r/min for 1 minute each time. At this time, viral RNA will be adsorbed on the column on the bottom of the membrane.

A.4 Add 500 µL of washing solution (AW1) to the column and centrifuge at 8 000 r/min for 1 min each time, discard AW1.

A.5 Add 500 µL of washing solution (AW2) to the column, centrifuge at 14 000 r/min for 3 min each time, discard AW2, and further separate Heart 14 000 r/min for 1 min to completely remove the residual ethanol on the membrane.

A.6 Add 60 µL of eluent (AVE) and let stand at room temperature for 1 min.

A.7 Place the column on a 1.5 mL centrifuge tube, and centrifuge at 8000 r/min for 1 min at 4 °C. The obtained RNA can be real-time fluorescent.

RT-PCR detection.

Lone Star Virus.indd 6.2019/9/12 14.00.53 ????? ????, ????, ??