SN/T 4877.15-2019Gene barcode screening methods - Part 15: Phytophthora (English PDF)

3.1 Phytophthora fungi

spearieres), Dhodocomycetes, Ascomycota.

A voucher specimen is a long-term preservation that provides a physical basis for identification or research and has sufficient archived information (collection and identification information, etc.) the specimen, it can be a complete biological individual or a part of it, or it can be the genetic material of the organism. The preservation of voucher specimens needs to be detailed Detailed specimen number, storage location and other detailed information for future verification.

The DNA barcode refers to a species that can represent the species in the body, a standard, sufficiently mutated, easily amplified, and relatively short DNA Fragment. Researchers use DNA barcode technology to identify species and inter-species relationships, and modify existing taxonomic conclusions.

The DNA barcode used to identify the quarantine Phytophthora is as follows.

Ribosomal Gene Transcription Spacer (Internal Tracance Striper, ITS for short)

5.1 Apparatus and equipment

Microscope, autoclave, ultra-clean workbench, tissue breaker, thermostatic water bath, desktop refrigerated centrifuge, micro-spectrophotometer, electric Sub-balances, ultra-pure water meters, vortex shakers, refrigerators, micropipettes (0.5 µL, 2.5 µL, 10 µL, 20 µL,.200 µL, 1000 µL), conventional PCR instruments, nucleic acid electrophoresis instruments, gel imaging systems, DNA Extraction instrument.

5.2 Main reagents

Purchase the following reagents or the corresponding fungal genome extraction kit. ethylenediamine tetraacetic acid sodium salt (Na2EDTA · 2H2O), hydrogen NaOH, Tris base, concentrated hydrochloric acid (HC1), cetyltrimethylammonium bromide (CTAB), sodium chloride (NaCl), polyvinylpyrrolidone (PVP), glacial acetic acid (CH3COOH), distilled water, chloroform (CHCl3), isoamyl alcohol, 70% ethanol.

Reagents required for PCR and electrophoresis detection. 10 × PCR buffer, deoxyribonucleoside triphosphates (dNTPs), ExTaq polymerase, primer Materials, ultrapure water, DL2000 Marker, agarose, GelRed nucleic acid gel dye.

6.1 Collection and processing of samples

The collection, isolation, purification and cultivation of samples were performed in accordance with the quarantine and identification methods for plant pathogenic fungi of Sn/T 2589.

6.2 Preparation of nucleic acids

Genomic extraction kits are used to prepare DNA, or modified CTAB extraction methods are used, see Appendix A.

6.3 Determination of DNA purity and concentration

The purity and concentration of DNA were measured with a micro-ultraviolet spectrophotometer, and the absorption values at 260 nm and 280 nm were obtained, and the nucleus was calculated.

The purity and concentration of the acid are calculated as follows.

DNA purity = OD260/OD280 the concentration of DNA = 50 × OD260 µg/mL PCR-grade DNA solution should have an OD260/OD280 ratio of 1.7 to 1.9.

6.4 Sequence Amplification and Sequencing

Amplify and sequence the ITS gene using universal primers (see Appendix B for specific steps), and place the sequence in the Genbank database or the Chinese inspection Alignment in the pest barcode DNA barcode database, if the sequence similarity with the Phyllostachys sp. ITS gene in the database is greater than 98%, then the sequence homology was analyzed.

8.1 Sample preservation

Strains isolated and eventually identified as quarantine target fungi should be transferred to the test tube slope, and registered and signed at 4 °C Keep it in a low temperature refrigerator, and transfer it regularly (30d ~ 60d), and freeze it for a long time if necessary.

8.2 Records of results and data retention

Complete experiment records include. sample source, type, time, experiment time, place, method and result, etc.

Sign with the reviewer. Photographs of electrophoresis results are required for PCR gel electrophoresis detection, and sequences need to be saved in electronic files.

SN/T 487.7.15-2019??? ????, ????,?

Appendix A

(Informative appendix) DNA extraction method A. 1 Take an appropriate amount of mycelia (500mg) and sterilized glass beads in a 2mL centrifuge tube, add 500µL 2 × CATA (60 ° C), and place the tissue cell wall on a tissue crusher. Incubate in a water bath for 30-60 minutes, occasionally shaking and mixing uniform;

A. 2 Add 500 µL (1. 1, equal volume) of chloroform/isoamyl alcohol (24. 1), mix well (3 min), 2,000 rpm, and centrifuge for 15 min; A. 3 Extract the supernatant, add 250 µL (1. 1, equal volume) of chloroform/isoamyl alcohol (24. 1), 2,000 rpm, and centrifuge for 15 min; repeat this step once;

A. 4 extract the supernatant, add an equal volume of isopropanol, mix well and precipitate for 30 min;

A. 5 After precipitation, centrifuge at 12,000 rpm for 10 min;

A. 6 Discard the liquid phase, add 400 µL of 70% ethanol, wash with shaking, and then centrifuge at 2,000 rpm for 5 min; repeat this step once; A. 7 Discard the liquid phase and dry the DNA in a clean bench, about 20 min;

A. 8 Add 50 or 100 µL double distilled water (as appropriate) to dissolve the DNA sample, and store the sample at -20 ° C until use.

SN/T 487.7.15-2019??? ????, ????,?

Appendix B

(Normative appendix) PCR amplification method

Table B. 1 Amplification primers

Target gene primer sequence amplified fragment ITS ITS1. TCCGTGAGGTTGAGACCTCGCGGGITTS4. TCCTCCCGCTTTATTAGATTGTC 644bp

Table B. 2 PCR reaction system (Take 25µL as an example)

Component volume (µL) dNTP mixture (10 mmol/mL each) 0.3 10 × PCR buffer (with Mg2 +) 2.5 Forward primer 1.0 Reverse primer 1.0 Tazyme 0.2 DNA template 1.0 ddH2O 19.0

Table B. 3 PCR reaction program (for gene ITS)

Step reaction temperature (°C) Number of time cycles Pre-denaturing 94 5min-Denaturing 94 30S Annealing 52 30S Extension 72 1min Extension 72 10min-SN/T 487.7.15-2019??? ????, ????,?

Appendix C

(Informative appendix) Species Name Strain Number 1 Host Collection Site ITGSBenk Registration Number SN/T 487.7.15-2019??? ????, ????,?

(Continued)

Species Name Strain Number 1 Host Collection Site ITGSBenk Registration Number

1 Bacteria Collection Center CBS. Culture Collectio Cultral Affirmation Bureau Schwarmlines, Fungal Biodiversity Centre, U-trecht, TheNeterlends; IMI. Culture Colocionion iocafUUCceUkCentre, Egham, UK; ATCC. Amercian Type SN/T 487.7.15-2019??? ????, ????,?

references

WiekeeS, LombardL, NahimaC, MotoshaK, ChuateiroteE, CheowangkonR, McKenzieEHC, Hyde inMycologue76. 1-29.

QhouN, ChenZ, CarrollG, ZhangN, ShivasRG, CaiL..2015. Pollyphachachracationitof ology 119. 433-446.

SN/T 487.7.15-2019??? ????, ????,?