SN/T 4877.14-2019DNA barcoding screening method - Part 13: Qurantine Sobemoviruses (English PDF)

6.1 Instruments and facilities

Enzyme-linked detector, electronic balance (sensibility. 0.0001g), qualitative PCR instrument, electrophoresis instrument, electrophoresis tank, gel imaging system, constant temperature water bath, low Refrigerators, ordinary refrigerators, centrifuges, etc .; micropipettes (2.5 µL, 10 µL, 20 µL, 100 µL,.200 µL, 1000 µL); enzyme-linked plates, mortars, etc .; isolation greenhouse.

6.2 Reagents

See Appendix B for reagents.

10.1 Results Recording and Data Preservation

Record sample information and test data, including sample source, plant species, sampling time and place, test time, method and results, and SN/T 478.14--2019 ????? ????, ????,?

Signed by personnel. For RT-PCR detection methods, electrophoretic photographs should be saved, and sequencing reports should be saved for sequencing results.

10.2 Sample preservation

Southern bean mosaic virus virus samples should be properly stored in an ultra-low temperature refrigerator, or stored at low temperature after lyophilization, and registered and Identification for review.

SN/T 478.14--2019 ????? ????, ????,?

Appendix A

(Informative appendix) Southern bean mosaic virus A. Morphology of virion Southern bean mosaic virus virus virions are equiaxed icosahedron (T = 3), without envelope, about 30 nm in diameter and 180 Protein subunit, each protein subunit has two regions, one forming an icosahedral shell approximately 3.5 nm thick, and the other forming within the virus Partial sequence of "arms".

A. 2 Genomic characteristics Leadframe (ORF) composition. ORF1, ORF2a, and ORF2b are all produced by translation of the genomic RNA, of which ORF2a is expressed through the leakage scanning mechanism; ORF2b forms a fusion protein with ORF2 through the -1 ribosome frameshift mechanism; ORF3 it is produced by subgenomic RNA translation. The motif encoding the replicase is located in ORF2b.

A. 3 types of viruses SN/T 478.14--2019 ????? ????, ????,?

A. 4 Host range

After the virus, mosaic or mottled symptoms usually appear on the leaves.

A. 5 Ways of transmission Spread by aphids, villous mottle virus (VTMoV) spreads through blind maggots. Some viruses can also be transmitted through seeds, such as southern vegetables Bean Mosaic Virus (SBMV), Southern Cowpea Mosaic Virus (SCPMV), and Quinoa Mosaic Virus (SoMV).

SN/T 478.14--2019 ????? ????, ????,?

Appendix B

(Normative appendix) RT-PCR detection B. 1 reagent B. 1.2 Trichloromethane B. 1.3 isopropanol B. 1.4 75% ethanol B. 1.5 Deionized water (DEPC treatment) B. 1.6 50 × TAE Tris 242g 57.1mL of glacial acetic acid Na2EDA · 2H2O 37.2g Add deionized water and make up to 1L. Add water to dilute to 1 × TAE.

B. 1.7 6 × loading buffer 0.25% bromophenol blue 40% (W/V) sucrose solution B. 2 Experimental steps B. 2.1 Total RNA extraction Weigh 0.1g of plant tissue plus liquid nitrogen and grind it into a powder form, quickly transfer it into a sterilized 1.5mL centrifuge tube, and add 1mL of TrizoL reagent, shake vigorously and shake to keep at room temperature for 5 min; centrifuge at 2,000 g for 10 min at 4 ° C, take the supernatant; add 0.2 mL of trichloromethane Mix with vigorous agitation and shaking; centrifuge at 2,000 g for 10 min at 4 ° C, take the supernatant; add 0.6 times the volume of isopropanol, mix by inversion, and keep at room temperature 5min; Centrifuge at 12 ° C for 10min at 4 ° C, discard the supernatant; wash the pellet with 75% ethanol, centrifuge at 7500g for 2min at 4 ° C, discard ethanol;

After the precipitate is sufficiently dried at room temperature, it is dissolved in 30 µL of deionized water (DEPC treatment) and stored at -20 ° C until use. Equivalent kits can also be used to extract total RNA.

B. 2.2 RT-PCR reaction See Table C for primers for RT-PCR detection. 1. 20 µL of cDNA synthesis reaction system. Add 6 µL of total RNA to a 0.2 mL reaction tube.

1 µL downstream primer Sobemo-RdRP-3 ' (20 µmol/L), 4 µL deionized water, 10 µmol/LdNTPs 1 µL, 65 °C 5min, put it on ice immediately after taking out, add 5 × First Strand Buffer 4µL, 40U/µL RnaseBlockRockuplease Inhibitor 1µL, 0.1mol/LDT2µL, 42 ° C water bath for 2min, and then add.200U/µL RevereTrancecrispase 1µL, 50min in 42 °C water bath and 15min in 70 °C water bath after mixing to synthesize cDNA. FirstStrandBuffer and RevereTran-SN/T 478.14--2019 ????? ????, ????,?

The amount of scriptase needs to be adjusted according to the brand of reverse transcriptase. A one-step RT-PCR kit can also be used for amplification.

Table B. 1 Primer sequence

Primer name sequence (5'-3 ') Amplified fragment Somemo-RdRp-5 ' Somemo-RdRp-3 ' RTNCCCCCCATNGTRACACCA Approximately 400bp Note. N ... A, C, g, T; R ... A, g; D ... g, A, T the reaction system is shown in Table B. 2.

Table B. 2 PCR reaction system

Component volume (µL) Deionized water 38.5 10 × PCR Buffer (MgCl2plus) 5 dNTP (10mm) 2 Upstream primer (20 µM) 1 Downstream primer (20 µM) 1 T enzyme (5U/µL) 0.5 cdna 2 Total reaction volume 50 Reaction parameters. 95 ° C for 3 min; 95 ° C for 30 s; 55 ° C for 45 s; 72 ° C for 45 s; 35 cycles; 72 ° C for 7 min. Can also be used One-step RT-PCR kit for amplification.

B. 2.3 Electrophoresis B. 2.3.1 Preparation of gel A 1.5% (W/V) agarose gel was prepared. Ethidium bromide can be directly added to agarose gel (concentration of 0.5 µg/mL), or stained with ethidium bromide after electrophoresis is completed.

B. 2.3.2 Electrophoresis Mix 1 µL of 6 × loading buffer with 5 µL of the sample, and then add it to the wells of the appropriate DNA molecular weight standards. After the end of the electrophoresis, the agarose gel was placed on a UV transilluminator for observation, and the results were taken and retained.

B. 3 result judgment B. 3.1 The positive control showed an amplification band of about 400 bp. The negative control and the blank control did not specifically amplify.

B. 3.2 The positive control showed an amplification band of about 400 bp. The negative control and the blank control did not specifically amplify.

Note 1. If necessary, further sequencing verification can be performed.

SN/T 478.14--2019 ????? ????, ????,?

Appendix C

(Informative appendix) Quarantine southern bean mosaic virus gene reference sequence > Souterbeammosaicvirus (NC_040060.2) CCCCCAAAAACCCTTGGTAGGCGCCCTTTTCGCCTCGCAACCGACCAAGCGCCAAAAGTCTGTCTTCAGCGATT TGAGAGGTCACAACATCTCTCTGTGTCTCTCTCGCGGTCGAACGCCCGATCATGCTGGTTTGTCGGTGC TGTTCCAAGAGCTGTGGAGGTGTTGGTCGTGGTAGAGGTAGGTAGGTAGGTATTAGTGGTGTGTTGTG ACAGAAGGTTGCTCCCATAGCGCCGTAGTGAATCGTCTCTGTCTCTAGCTACTAGCTCTCTGC CTCTCGGGATTGCGCACATCTCATCATAGATCAGACTAGCTCTCTGTGTATTAGTAGTCTGTGTCTCTATT GCACTCTCTCTCACACAAAACCTCCCAGAATATCGGTGTGCCTGTAGCTCTAGATCTTGGTCTTCCCCCTG GTTGATGCCGCCCATTGGGTGTAGTA > Sowbenemos saicivirus (GZ 845002.2) CCCCCAAAAACCCTTGGTAGGCGCCCTTTTCGCCTCGCAACCGACCAAGCGCCAAAAGTCTGTCTTCAGCGATT TGAGAGGTCACAACATCTCTCTGTGTCTCTCTCGCGGTCGAACGCCCGATCATGCTGGTTTGTCGGTGC TGTTCCAAGAGCTGTGGAGGTGTTGGTCGTGGTAGAGGTAGGTAGGTAGGTATTAGTGGTGTGTTGTG ACAGAAGGTTGCTCCCATAGCGCCGTAGTGAATCGTCTCTGTCTCTAGCTACTAGCTCTCTGC CTCTCGGGATTGCGCACATCTCATCATAGATCAGACTAGCTCTCTGTGTATTAGTAGTCTGTGTCTCTATT GCACTCTCTCTCACACAAAACCTCCCAGAATATCGGTGTGCCTGTAGCTCTAGATCTTGGTCTTCCCCCTG GTTGATGCCGCCCATTGGGTGTAGTA SN/T 478.14--2019 ????? ????, ????,?