Valid

SN/T 5145.4-2019Rapid ldentifieation of animal ingredient in export food and feed -- Part 4: Detection of Camelus Ingredient PCR-Lateral flow dipstick method (English PDF)

Preview PDF

This is a limited preview

Buy now to download the full PDF (7 pages)

Need quotation for your management?

Get a formal quotation for SN/T 5145.4-2019 in 30 minutes.

Issued by

General Administration of Customs

Level / Type

National · Recommended

Issue date

October 25, 2019

Implementation date

May 1, 2020

Scope

SN/T 5145.4-2019 (Rapid ldentifieation of animal ingredient in export food and feed -- Part 4: Detection of Camelus Ingredient PCR-Lateral flow dipstick method) is available as an English-translated PDF.

SN/T 5145.4-2019 — This section specifies the PCR-test strip method for detecting camel-derived components in food and feed. This section applies to the qualitative detection of camel-derived components in meat, meat products and feed.

Found what you need?

Document preview — SN/T 5145.4-2019

National Standard of the People's Republic of China

Classification: C 53

Issued by: General Administration of Customs

Foreword
1 Scope
2 Normative references
3 Terms, definitions and abbreviations
3.1 Terms and definitions
3.2 Abbreviations
4 Method principle
5 Reagents and materials
5.2 Reagents
6 Equipment
6.7 Nucleic acid protein analyzer or UV spectrophotometer
7 Inspection steps
7.1 Sample preparation
7.2 DNA extraction
7.3 Determination of DNA concentration and purity
7.4 PCR amplification
8 Quality control
9 Results judgment and report
9.1 Determination of results
9.2 Results report
10 Measures to prevent cross-contamination during testing
11 Waste disposal
12 Detection limit

Foreword

Sn/t 5145 "Method for rapid detection of animal-derived ingredients in exported food and feed" is divided into the following 13 parts.

--- Part 1. Cat component test PCR-test strip method;

--- Part 2. Detection of mink composition by PCR-test strip method;

--- Part 3. Detection of deer components by PCR-test strip method;

--- Part 4. Detection of camel composition by PCR-test strip method;

--- Part 5. Detection of dog ingredients by PCR-test strip method;

--- Part 6. Detection of bovine constituents by PCR-test strip method;

--- Part 7. Detection of sheep composition by PCR-test strip method;

--- Part 8. Detection of donkey components by PCR-test strip method;

--- Part 9. Detection of fox composition by PCR-test strip method;

--- Part 10. Detection of goose composition by PCR-test strip method;

--- Part 11. Detection of duck composition by PCR-test strip method;

--- Part 12. Detection of turkey composition by PCR-test strip method;

--- Part 13. Pigeon composition detection PCR-test strip method;

This section is Part 4 of Sn/T 5145.

This section is drafted in accordance with the rules given in GB/T 1.1-2009.

Please note that some elements of this document may involve patents. The issuer of this document is not responsible for identifying these patents.

This section is proposed and managed by the General Administration of Customs of the People's Republic of China.

This section was drafted. Tianjin Customs, People's Republic of China, Tianjin Normal University, China Academy of Inspection and Quarantine, Beijing Huada Egg White Matter R & D Center Co., Ltd.

1 Scope

This section specifies the PCR-test strip method for detecting camel-derived components in food and feed.

This section applies to the qualitative detection of camel-derived components in meat, meat products and feed.

2 Normative references

The following documents are essential for the application of this document. For dated references, only the dated version applies to this document.

file. For undated references, the latest version (including all amendments) applies to this document.

GB/T 6682 Analytical laboratory water specifications and test methods GB/T 14699.1 Feed sampling GB/T 27403-2008 Laboratory quality control specifications Food molecular biological testing

3 Terms, definitions and abbreviations

3.1 Terms and definitions

The following terms and definitions apply to this document.

3.1.1

It belongs to Mammalia, Oddhoof, Equine, Equus. The camel component in this standard refers to the camel-specific DNA fragment.

3.2 Abbreviations

The following abbreviations apply to this document.

DNA. deoxyribonuleicid, DNA.

dNTP. deoxyribonulosideritis, deoxynucleotide triphosphate.

CTAB. cetyltriammonium bromide, cetyltrimethylammonium bromide.

Tris. Tris (Hydroxymetyl) aminomethan, trimethylolaminomethane.

EDTA. Ethylenediacetic acid, ethylenediamine tetraacetic acid.

FITC. Flooresin 5-isotopeate, isothiocyanate.

4 Method principle

Sample cells were disrupted with lysate, genomic DNA was extracted by phenol-chloroform method, and the extracted DNA was used as a template, using upstream and downstream the primers were amplified by PCR using isothiocyanate (FITC) and biotin (Biotin) markers, respectively.

PCR products with isothiocyanate and biotin molecules were obtained at both ends. Rabbit polyclonal antibody containing gold-labeled anti-isothiocyanate SN/T 5145.4-2019 Screening and detection of PCR products, and sequencing of PCR-positive products Confirmation.

5 Reagents and materials

Unless otherwise specified, the reagents are analytical or biochemical reagents, and the experimental water meets the requirements of GB/T 6682.

5.1 Primer (pair) sequences and markers for detecting camel-derived components are.

Camel component amplification primers are shown in Table 1.

Table 1 Primers for testing

Species name primer sequence (5 ' -> 3 ') 5 ' end marker target gene Camel F. 5'-CATGAGACAAAAAATTCGA-3 ' Isothiocyanate (FITC) R. 5'-GGCGCGGTTAG TCCTAGGTGTTG-3G Biotin COX

5.2 Reagents

5.2.1 ExTaqHotStatDNA polymerase (Taq, Termusauticu).

5.2.2 DNTPs. dATP (deoxyadenosophate, deoxyadenosine triphosphate), dTPP (deoxythymine)

triphosphatate (deoxythymidine triphosphate), dctp (deoxadenine cyclotin phosphate) dGTP (deoxiy nooninphosphate, deoxyguanosine triphosphate).

5.2.3 10 × PCR buffer..200 mmol/L Tris-HC1 (pH 8.4),.200 mmol/LKCl, 20 mmol/LMGCl2.

5.2.4 Trichloromethane (chloroform).

5.2.5 Isopropanol.

5.2.6 CTAB extract solution. 20g/LCTAB, 1.4mol/LNaCl, 0.1mol/LTris-HC1, 0.02mol/LNA2EDTA, pH 8.0.

5.2.7 CTAB precipitation solution. 5g/LCTAB, 40mmol/LnaCl, pH 8.0.

5.2.8 Phenol/trichloromethane/isoamyl alcohol solution. According to Tris saturated phenol. trichloromethane. isoamyl alcohol solution volume ratio of 25. 24. 1 Preparation.

5.2.9 Trichloromethane/isoamyl alcohol solution. Prepare according to the volume ratio of trichloromethane. isoamyl alcohol solution is 24. 1.

5.2.10 70% ethanol (V/V).

5.2.11 NaCl solution (1.2mol/L).

5.2.12 Proteinase K (20mg/mL).

5.2.13 Test strips. a rabbit polyclonal antibody containing gold-labeled anti-isothiocyanate and a universal nucleic acid test strip immobilized with streptavidin Strips can be assembled by themselves using purchased raw materials (see Appendix A) or equivalent commercial test strips.

5.2.14 Developing solution. 10 mmol/L Tris, 1% BSA, 1% (v/v) Tween 20, and NaOH at a concentration of 0.05 mmol/L; or Use equivalent commercial products.

6 Equipment

6.1 Centrifuge (centrifugal force >=12,000g), 4 °C ± 1 °C.

6.2 Micropipettes (100 µL to 1,000 µL, 20 µL to.200 µL, 2 µL to 20 µL, 0.5 µL to 10 µL).

6.3 PCR instrument.

SN/T 5145.4-2019

6.4 Constant temperature water bath, 65 °C ± 1 °C.

6.5 Balance. Sensitivity is 0.01g.

6.6 pH meter.

6.7 Nucleic acid protein analyzer or UV spectrophotometer

7 Inspection steps

7.1 Sample preparation

7.1.1 Food

Grind and mix the solid sample to be tested, divide into three parts, one of which is the test sample, and the other two are the retained sample. Liquid samples are dispensed directly.

Processed foods may be rich in salt, sugar, plant pigments, and colored substances from fermentation, which will affect downstream experimental operations.

The formula removes impurities such as salt, sugar and pigment in the sample as much as possible.

7.1.2 Feed

Feed samples are sampled according to GB/T 146499.1, or if the particle size is 20 meshes,.200mg is weighed, 60 meshes are weighed 100mg, 100 meshes weighed 100mg.

7.2 DNA extraction

Weigh a 100mg sample into a 2mL centrifuge tube, add 1mL of CTAB extract, and add 10µL of 20mg/mL proteinase K.

Incubate at 65 ° C for 1h. During this time, shake and mix from time to time. Ensure that the sample is freely suspended in the liquid. If necessary, add an appropriate amount of CTAB extraction buffer.

Centrifuge for 10min at 1200g after transfer, the supernatant to a 2mL centrifuge tube, and add an equal volume of room temperature phenol/trichloromethane/isoamyl alcohol (25. 24. 1) mix upside down, centrifuge for 10 min at 1200 g speed; transfer the supernatant to another sterilized centrifuge tube, add an equal volume of three Chloromethane/isoamyl alcohol (24. 1), mix by inversion, centrifuge at 2,000 g for 10 min at room temperature; transfer the supernatant to a clean centrifuge tube, and add the isosome the accumulated CTAB precipitation solution was mixed and precipitated at room temperature for 1 h. Add 0.8 times the volume of isopropyl alcohol or 2 times the volume-20 ° C refrigerator pre-cooled anhydrous Ethanol was mixed well, left at -20 ° C for 30 min, and centrifuged at 1200 g for 10 min at 4 ° C. The supernatant was discarded, and the precipitate was washed once with 70% ethanol, 1200 g Centrifuge at 4 ° C for 10 min, discard the supernatant, and dry at room temperature. Add 50 µL double-distilled water, mix at room temperature for 10 min, and store at -20 ° C. In the above method, template DNA can be extracted using an equivalent DNA extraction kit.

7.3 Determination of DNA concentration and purity

Take 5µL of DNA solution and dilute with distilled water to 1mL. Use a nucleic acid protein analyzer or UV spectrophotometer to detect the absorbance values A260 and A280 at 260nm and 280nm respectively. The concentration of DNA is calculated according to formula (1).

C = A × N × 50/1000 (1) in the formula.

C --- DNA concentration in micrograms per microliter (g/µL); A --- absorbance at 260nm;

N --- nucleic acid dilution factor.

When the A260/A280 ratio is between 1.7 and 1.9, it is suitable for PCR amplification.

7.4 PCR amplification

7.4.1 PCR reaction system

See Table 2.

SN/T 5145.4-2019

Table 2 PCR reaction system

Reagent volume

10 × PCR buffer (containing 20mm Mg2 +) 2.0 µL Forward primer (5µmol/L) 0.8µL Reverse primer (5µmol/L) 0.8µL ExTaHotStat (5U/ul) 0.2µL DNA template (4ng/µL) 1.0µL dNTP (2.5mMeach) 2.0µL Sterilized ddH2O 13.2 µL

7.4.2 Reaction conditions

Pre-denaturation at 94 ° C for 5 min; denaturation at 94 ° C for 30 sec, annealing at 55 ° C for 30 sec, extension at 30 ° C for 30 sec, and entering 72 ° C after 30 cycles 5min. The PCR reaction conditions changed slightly with different PCR instruments.

During the detection, a positive control, a negative control and a blank control were set. Use a camel-derived sample as a positive control.

Samples containing no camel-derived components were used as negative controls, and equal volumes of double-distilled water were used instead of template DNA as blank controls.

7.4.3 Test strip test

5 µL PCR product was spotted on the nucleic acid test strip sample pad, added to 95 µL developing solution for detection, and the result was observed after 5 min.

8 Quality control

An experiment is considered invalid if one of the following conditions is not met.

a) Blank control. The quality control line turns red, and the detection line does not turn red.

b) Negative control. The quality control line turns red, and the detection line does not turn red.

c) Positive control. the quality control line turns red, and the detection line turns red.

9 Results judgment and report

9.1 Determination of results

The quality control line of the test strip turns red, and the detection line turns red. The PCR amplification product is suspected positive. Suspected positive products were confirmed by sequencing (See Appendix B for the sequence).

The quality control line of the test strip turned red, the detection line did not change color, and the PCR amplification product was negative.

9.2 Results report

If the PCR product test strip is suspiciously positive, and the sequencing result has 97% or more homology with the NCBI gene bank, it is judged as Contains camel-derived ingredients, and the results are reported as detected camel-derived ingredients;

The PCR product test strip was suspiciously positive, and the sequencing result was less than 97% homologous with the NCBI gene bank.

Analysis to determine whether it contains camel source ingredients;

The PCR product test strip was negative and was judged to contain no camel-derived components. The results were reported as no camel-derived components.

SN/T 5145.4-2019

10 Measures to prevent cross-contamination during testing

Measures to prevent cross-contamination during the test are performed in accordance with the provisions of Appendix D of GB/T 27403-2008.

11 Waste disposal

The waste during the test is collected and incinerated in an incinerator.

12 Detection limit

The minimum detection limit (LOD) of the method specified in this section is 0.1% (mass fraction).

SN/T 5145.4-2019

Appendix A

(Informative appendix) Rabbit polyclonal antibody containing gold-labeled anti-isothiocyanate and universal nucleic acid detection test strip with immobilized streptavidin A. 1 Composition A. 1.1 Anti-FITC antibody monoclonal or polyclonal antibody.

Monoclonal antibody. Anti-FITCantibody mouse monoclonal antibody Polyclonal antibody. Anti-Fluorescein rabbit polyclonal antibody A. 1.2 Secondary antibody on quality control line. According to the above rabbit polyclonal antibody or mouse monoclonal antibody scheme, sheep anti-rabbit or goat anti-mouse antibody can be selected respectively.

A. 1.3 streptavidin. recombinant streptavidin, recombinant Streptavidin protein expressed in E. coli A. 2 Test strip structure 1 --- absorbent filter paper pad;

2 --- conjugate pad with cross-linked body of FITC antibody (rabbit) and colloidal gold particles;

3 --- lateral chromatography matrix (nitrocellulose membrane);

4 --- test strip with streptavidin;

5 --- quality control belt, with antibodies that can bind rabbit-derived antibodies;

6 --- substrate;

7 --- absorbent pad.

A. 3 Principle of test strip detection Rabbit polyclonal antibody containing gold-labeled anti-isothiocyanate (FITC) on the absorbent pad of the test strip the FAM-labeled molecule on the chain is bound, and streptavidin is fixed at the position of the detection line, and it can be biotin on the other chain of the PCR product.

Combined.

The positive PCR amplification product is first bound to gold-labeled carboxyfluorescein antibody under the action of the developing solution, and upwards through the siphon effect.

When the streptavidin is passed through the position where the streptavidin-fixed detection line is passed, it is captured by the streptavidin at the position due to the biotin label.

It shows a brownish red color. The excess product continues to move up to the position of the quality control line where the goat anti-rabbit antibody is fixed.

The cloned antibody was captured on the quality control line, showing two bands.

Non-specifically amplified PCR products cannot be labeled with gold-labeled isothiocyanate antibodies because they are not labeled with biotin or isothiocyanate Bind and are captured by streptavidin, so they cannot show color at the position of the detection line, and the PCR primers that are not involved in the reaction have isothiocyanate the salt is labeled, so it can also be captured by the isothiocyanate antibody and move up until the quality control line is captured by the goat anti-rabbit antibody to develop color.

SN/T 5145.4-2019

Appendix B

(Informative appendix) PCR product sequencing results CATGAGACAAAAAATCTCAATTCCGCGAAATATTATGTGTAGGGGGTAGAGCTGTACTCTCTCTCCGCGC AACATTTTCTCTAGGTCTCTCTGCCGCGATAGCCCTGCAGCGCTCATCTCTGCACCCTCCGCATTGCCCATTAC TACATGAGAAACACATCTCTCATCTCTCGCGTGCTCTTTTTCTCTCTCTAGCTCGTGGTGTCTGTAGTG GTGTTTATGTGTGTAGAGAGAGCGCTCTTCGCGCTGCGAGAGCGGTAGCGTCAGACGCTGAGAGACCTAGAC GCC SN/T 5145.4-2019

......
This preview omits tables, figures, formulas and parts of the technical clauses. The complete document — 7 pages — is available in the English PDF.

Referenced standards

Normative references

How to Download SN/T 5145.4-2019

1
Add to cart
Click "Download PDF" on this page and choose "Buy this standard". You can add more standards before checkout.
2
Checkout
Enter your email and billing details. Payment is processed securely by Stripe (cards or bank transfer). Prefer bank details? Request a quotation (min. order $300).
3
Instant delivery (0–9 sec)
Delivery is automatic: within seconds of payment you'll receive an email with a secure download link. The link stays valid for 72 hours.
4
Invoice included
A tax invoice is attached to the confirmation email. Need a custom invoice? Contact us.