SN/T 5106-2019Dengue vector mosquito DNA barcode identification method (English PDF)

Foreword

This standard was drafted in accordance with the rules given in GB/T 1.1-2009.

This standard is proposed and managed by the General Administration of Customs of the People's Republic of China.

This standard was drafted. Fuzhou Customs, People's Republic of China.

Drafters of this standard. Fang Yiliang, Zhang Jianqing, Lin Xingzhong, Wang Yuping, Huang Enjiong, Fang Changtian, Wu Rongquan.

SN/T 5106-201919 ????? ????, ????, ??

Identification method of dengue vector mosquito DNA barcode

1 Scope

This standard specifies DNA extraction, gene amplification, and sequence alignment of dengue fever vector mosquito DNA barcode identification methods.

Analysis, results judgment, etc.

DNA barcode identification of specimens such as stubble and incomplete limbs.

2 Normative references

The following documents are essential for the application of this document. For dated references, only the dated version applies to this document.

file. For undated references, the latest version (including all amendments) applies to this document.

GB 1849 General requirements for laboratory biosafety SN/T 1876 Procedures for the collection, production and preservation of medical vector biological specimens SN/T 275.4 Self-protection code for health and quarantine personnel Part 4. Laboratory personnel SN/T 4278 Code of Practice for Identification of Medical Vector Insects DNA Bar Codes at Frontier Ports Application of polymerase chain reaction (PCR) in clinical diagnosis of WS/T 230

3 Method principle

Use universal primers to amplify specific fragments of the COI gene in mitochondrial DNA, clone the PCR product or directly sequence Then, an effective sequence with a length of not less than 500 bp is obtained, and compared with the standard sequence of this standard, so as to achieve rapid and accurate identification of species purpose.

4 Identification procedure

5 Result judgment

The result of the comparison is Aedes albopictus and the similarity is greater than or equal to 98%.

Aedes aegypti and its similarity greater than or equal to 98% are Aedes aegypti (see Appendix F).

SN/T 5106-201919 ????? ????, ????, ??

Appendix A

(Informative appendix) Main equipment and reagents A. 1 Instruments and appliances A. 2 Consumables 1.5ml centrifuge tube, 0.2ml PCR tube, pipette TIPS of each range, powder-free disposable gloves.

A. 3 Reagents and materials Reagents required for PCR. 75% ethanol by volume, DNA extraction kit for animal tissue genomic DNA, TaQPCRMastirix (Containing dye), PCR product purification kit, agarose, DNA standard molecular weight standard, TAE electrophoresis solution.

Extraction of DNA using trace tissues requires. Tris-HC1, EDTA, Nonidep-40, 100 µg/mL proteinase K. Reagents required for cloning and sequencing. pGM-T Victor, TOP10 competent cells, pGM-T Ligion Kit, PCR Identificator KitkitRecombinantmpGM-TClone, IPTG, X-gal.

SN/T 5106-201919 ????? ????, ????, ??

Appendix B

(Informative appendix) Trace tissue DAN extraction method B. 1 Configure the lysate Configured with 100 mL of lysate (10 mmol/L Tris-HCClpH8.0, 1 mmol/LEDA, 1% Nonidep-40, 100µg/mL proteinase K) B. 2 Thermal cracking Pipette 35 µL lysate, add sample homogenate, add 35 µL ddH2O, and boil for 5 min.

B. 3 centrifugation

Centrifuge at 10,000 r/min for 10 min and take the supernatant for later use.

SN/T 5106-201919 ????? ????, ????, ??

Appendix C

(Informative appendix) Amplification product electrophoresis gel map Note. M. DNA standard molecular weight standard; 1. negative control; 2. pupal sample; 3. larva sample; 4. adult sample.

Figure C. 1 electrophoresis gel map of amplification products

SN/T 5106-201919 ????? ????, ????, ??

Appendix D

(Normative appendix) Aedes albopictus barcode standard sequence (COI) Log in to the website NCBI and enter the registration number. KZ 8257475, you can get the following sequence.

GGTCACACAAAATCATATAGAATATGTAGATCATGTATCTATTCTTTGTCGTTATTGGTCTGTAGTA TAGTCCGGAGACTCTCATAGAGGTGTTTATTAGTTCGTATTAGGACTCTAGGTACCTCTGTGTATTATTA Ttggaaatgatkatakatattatatattagattgtgttctctgtctctgtctttttattattattattatttttt ATTGACTCTCTCTATTATCATCAGTAGATAGATAGAGAAATAGGTGCGCGAGCGATCGTGGTAGACATT TTACTCCCTCCCTCTCTCTCTCTAGCGAGAGCGCTCTGTCGGTCGGTCTGTCTGTGTATTGTCTGTTTTT Ttctctctcattgtattctctggaattttctctctctattgtgtgtggggggatcgtattattattattactatccatgtat ATTAATATACTGATCGGTGCAGGATATCTATTTAGATTCCGATCCCTCTATTATGTGTTTGTGTCTGTTA GTATTATCATACGTCTCTATTATCTATCTCTCTCTCTCTCTCTCTGTGTAGGTCTAGGTCTATTACGTATT TATTA ACAGAGACCCGAAACCTTAAAAATACCATCTCTTTCTGTCTATCACGTCAGGAGAGAGCCCCTA TTTTATACACCAACACCTATCATTCATCACTGTAGCGGTCGACCACAAAAAAACATA; the horizontal part is the primer, the sequence not included in column alignments.

SN/T 5106-201919 ????? ????, ????, ??

Appendix F

(Informative appendix) Sequence alignment (BLAST) process F. 1 Go to the website Enter the homepage of the website. http. // blast. ncbi. nlm. nih. gov/Blast. cgi, see Figure F. 1.

Figure F. 1 BLAST website homepage

Copy and paste the standard sequence of Aedes albopictus in Appendix E or the standard sequence and target sequence of Aedes aegypti in Appendix F into the blank columns respectively.

After that, select other options as the default, and click BLAST to submit, as shown in Figure F. 2.

Figure F. 2 Input target sequence and standard sequence alignment page

SN/T 5106-201919 ????? ????, ????, ??

F. 3 Comparison results demonstration

Figure F. 3 and Figure F. As shown in Figure 4, the alignment similarity (Idnet) between the target sequence and the standard sequence is greater than or equal to 98%, which can be determined as the same type.

Figure F. 3 Demonstration of alignment results between Aedes aegypti target sequence and standard sequence

Figure F. 4 Demonstration of alignment results between Aedes albopictus target sequences and standard sequences

SN/T 5106-201919 ????? ????, ????, ??