SN/T 4876.7-2019DNA barcode method Part 7: Poinsettia subgenus (English PDF)
DNA条形码方法 第7部分：一品红亚属
This is a limited preview
Buy now to download the full PDF (8 pages)
Need quotation for your management?
Get a formal quotation for SN/T 4876.7-2019 in 30 minutes.
Issued by
General Administration of Customs
Level / Type
National · Recommended
Issue date
September 3, 2019
Implementation date
March 1, 2020
Scope
SN/T 4876.7-2019 is the English-translated version of DNA条形码方法 第7部分：一品红亚属.
SN/T 4876.7-2019 — This section specifies the DNA barcode detection method for common species of Euphorbia poinsettia subgenus. This section applies to the determination, comparison analysis and judgment of DNA barcodes of common species of Euphorbia poinsettia subgenus.
Found what you need?
Document preview — SN/T 4876.7-2019
National Standard of the People's Republic of China
- Classification
- B 16
Issued by: General Administration of Customs
Contents
- Foreword
- 1 Scope
- 2 Normative references
- 3 Terms and definitions
- 4 Basic Information of the Subgenus Poinsettia
- 5 Method principle
- 6 Equipment and main reagents
- 6.1 Apparatus and equipment
- 6.2 Main reagents
- 7 Screening and identification methods
- 7.1 Processing of samples
- 7.2 DNA preparation
- 7.3 DNA barcode gene fragment amplification
- 7.4 Detection of PCR products
- 7.5 Sequencing and Sequence Processing
- 8.1 Determination of China's quarantine pest DNA barcode identification system
- 8.2 Determination of plant pest quarantine and identification system
- 8.3 Determination of International General Database
- 9 Specimen and original data preservation
- 9.1 Specimen preservation
- 9.2 Raw data preservation
- 10 Forward primer, pmol/µL 2.0
Foreword
This section is drafted in accordance with the rules given in GB/T 1.1-2009.
Please note that some elements of this document may involve patents. Publication of this document the agency is not responsible for identifying these patents.
This section is proposed and managed by the General Administration of Customs of the People's Republic of China.
This section was drafted. Ningbo Institute of Inspection and Quarantine Science and Technology, Nanjing Customs, People's Republic of China Xin, Animal and Plant and Food Inspection and Quarantine Technology Center of Shanghai Customs, People's Republic of China, Guangzhou Customs, People's Republic of China, China Inspection and Quarantine Institute of Epidemiology, Fuzhou Customs, People's Republic of China, Qingdao Customs, People's Republic of China.
The drafters of this section. Xu Ying, Fu Jianguo, Yin Liping, Zhang Jihong, Zhang Huili, Fu Yining, Wu Hairong, Fan Xiaohong, Yu Wentao, Song Tao.
SN/T 487.67-2019
SN/T 4876 "DNA Barcoding Method" is divided into 7 parts.
--Part 1. Quarantine milk termites;
--Part 2. Quarantine broken eye Monochamus;
--Part 3. Quarantine volume moth;
--Part 4. Quarantine Sorghum
--Part 5. Datura;
--Part 6. Pleurotus
--Part 7. Poinsettia subgenus.
This section is part 7 of SN/T 4876.
DNA Barcoding Methods Part 7. Subgenus Poinsettia
1 Scope
This section specifies the DNA barcode detection method for common species of Euphorbia poinsettia subgenus.
This section applies to the determination, comparison analysis and judgment of DNA barcodes of common species of Euphorbia poinsettia subgenus.
2 Normative references
The following documents are essential for the application of this document. For dated references, only the dated version applies to this document.
file. For undated references, the latest version (including all amendments) applies to this document.
GB/T 3214 quarantine identification method
3 Terms and definitions
The following terms and definitions apply to this document.
DNA barcodes are short, standardized fragments of genes used to distinguish between different species. This fragment has obvious legacy among species Mutation and differentiation and easy PCR amplification.
The sequence of the sequence from 5 'to 3' is as follows. external transcription spacer (ETS), 18S gene, internal transcription Spacer 1 (ITS1), 5.8S gene, internally transcribed spacer 2 (ITS2), 28S gene, and intergenic sequence spark, IGS). The 18S, 5.8S, and 28S genomic sequences in ribosomal RNA tend to be conserved in most organisms, and Change is small, while the internal transcription spacers ITS1 and ITS2 are non-coding regions, they have less selection pressure, relatively large changes, and Enough to provide the heritable traits required for a detailed systematic analysis. The amplified region selected by this standard includes 5.8S partial sequence, ITS2 the full sequence and the 28S partial sequence were amplified with a total length of about 449 bp, of which the length of the tooth split ETS2 was 219 bp.
Chloroplast NADH dehydrogenase complex F subunit gene ChloroplastNADhyderogensingsubunitF, position in the small single copy region of the chloroplast genome, it is located at the end of the hydrophobic arm of the thylakoid NDH complex. Hypothetical chloroplast NADH 727bp.
4 Basic Information of the Subgenus Poinsettia
Euphorbia is one of the most genus in the angiosperms, with about 2,000 species, which are found all over the world, among which Africa and Central and South America are more common.
SN/T 4876.7--2019 ????? ????, ????,?
Mayfield (1997) classified the Euphorbia poinsettia subgenus. There are about 24 species of this subgenus in the world.
Halberd, David Euphorbia and Orangutan are harmful weeds, and poinsettia and orangutan are garden plants. See GB/T 3214 for detailed information.
5 Method principle
Identification.
6 Equipment and main reagents
6.1 Apparatus and equipment
PCR instrument, electronic balance (sensibility. 0.01g), freeze-mix mill, electrophoresis instrument, gel imaging system, high-speed refrigerated centrifuge, dissection Mirror, vortex shaker, refrigerator, water bath, sequencer, autoclave, adjustable micropipette (2 µL, 10 µL, 20 µL, 100 µL, 200 µL, 1000 µL) and corresponding tips, centrifuge tubes, PCR tubes, etc.
6.2 Main reagents
Unless otherwise specified, all reagents are analytical grade or biochemical reagents.
Plant Genome Extraction Kit, Ultrapure Water, DNA Marker, Agarose, Nucleic Acid Gel Dye, Liquid Nitrogen, Deoxyribonucleoside Triphosphate (DNTPs), Ta enzyme, 10 × PCR buffer, 10 × loading buffer, 50 × TAE buffer, primers (see Appendix B.1). CTAB method Extraction reagents (see Appendix A.1).
7 Screening and identification methods
7.1 Processing of samples
See GB/T 3142 for sample identification. Plant material that needs to be extracted from DNA (1-2 seeds, silica gel dried leaves are 10mg), put into a 2mL round bottom centrifuge tube, add 2 steel balls to each tube, add liquid nitrogen and grind for 3min using a frozen mixing mill (30 times/second).
7.2 DNA preparation
Total plant DNA was extracted using a commercial plant genome extraction kit or a modified CTAB method. improved refer to Appendix A for the CTB method. 2.
7.3 DNA barcode gene fragment amplification
See Appendix B for conditions.
7.4 Detection of PCR products
SN/T 4876.7--2019 ????? ????, ????,?
7.5 Sequencing and Sequence Processing
45 µL of the remaining PCR amplification product was taken and separated by 1.5% agarose gel electrophoresis. The target fragment was purified using DNA product purification kit and sequenced. Sequencing primers are the same as PCR amplification primers.
Sequencing results were edited using sequence splicing software, peak maps were compared, sequence directions were determined, sequencing primer sequences were removed, and sequencing was performed at both ends Sequences with mass Q value 8 result judgment
8.1 Determination of China's quarantine pest DNA barcode identification system
To enter the species identification page. After entering the FASTA format (or plain text format) sequence in the identification box, click "Submit Evaluation", the system After BLAST, the identification result is automatically generated (see Appendix C). When the 10 most similar sequences are the same species, the maximum similarity Supplemented by other identification methods.
8.2 Determination of plant pest quarantine and identification system
The query sequence was analyzed and compared, and the species that met the identification characteristics of this group and had a similarity of 100% was determined to be the unknown species. ITS2 and Please refer to Appendix D for the operation method of "physical and biological quarantine identification system".
8.3 Determination of International General Database
Log in to the GenBank database BLAST authentication system (http.//blast.ncbi.nlm.nih.gov/Blast.cgi) to the obtained ITS2 the species. See Appendix E for the gene sequence information of Euphorbia dentata and common approximate species.
9 Specimen and original data preservation
9.1 Specimen preservation
Store plant tissues or DNAs that are ultimately identified as quarantine target species at -20 ° C. And indicate the source, host, and collection the time, place and collector shall be kept for one year for re-inspection. If a trade dispute is involved, it shall be kept until the dispute is resolved.
9.2 Raw data preservation
After the sample is tested, its original record (including DNA sequence and sequencing peaks) and the inspection report must be archived to ensure proper protection.
Management for re-inspection, negotiation and arbitration.
SN/T 4876.7--2019 ????? ????, ????,?
Appendix A
(Informative appendix) DNA extraction method (improved CTAB method) A. 1 reagent A. 1.1 CTAB Extraction Solution CTAB 20g/L, sodium chloride 1.4mol/L, Tris0.1mol/L (pH8.0), EDTA0.02mol/L (pH8.0), autoclaving spare.
A. 1.2 TE buffer (pH 8.0) Add 1mol/L Tris-HCL (pH8.0) 10mL and 0.5mol/LEDA (pH8.0) solution 2mL, add water to volume to 1000mL. Sterilize for 20 min at 103.5 kPa (121 ° C).
A. 1.3 Trichloromethane. isoamyl alcohol solution Trichloromethane and isoamyl alcohol were mixed in a volume ratio of 24. 1.
A. 1.4 Isopropanol.
A. 1.5 70% ethanol (volume fraction).
A. 2 Extraction steps Add 600 µL of CATAB extract, which has been preheated to 65 ° C, into a 2ml centrifuge tube containing plant powder and mix thoroughly with shaking; 30 minutes at 65 ° C, mix by inverting from time to time; centrifuge at 10,000 r/min for 5 minutes, and take the supernatant... Isoamyl alcohol (V. V = 24. 1) Extract once; take the supernatant, add an equal volume of isopropanol, and precipitate for more than 10 min at 4 ° C, then centrifuge at 2,000 r/min for 10 min and discard.
Wash with 70% ethanol 1 or 2 times. After drying, add 50 µL TE buffer to dissolve the precipitate and store it in a refrigerator at –20 ° C until it is frozen.
SN/T 4876.7--2019 ????? ????, ????,?
Appendix B
(Normative appendix) B. 1 Primer sequence the primer sequences are shown in Table B. 1.
Table B. 1 Primer sequence
Target gene primer sequence amplified fragment size (bp) ITS2 ITS3PITS3R GCATTCCGATGAGAGACGAGCG GACCGCTCTCTCACGACCATAAT Approx. 450 bp Ttgtatactatagtgttagtag CGAAAACATATATAAAATAGCGGTTAAA Approx. 770 bpp B. 2 PCR reaction system and parameters the PCR reaction system and parameters are shown in Table B. 2.
Table B. 2 PCR reaction system and parameters
Ingredient stock solution concentration 50µL reaction system loading volume (µL) dNTP mixture 2.5 mmol/L 4.0 10 × PCR buffer (with Mg2 +)-5.0
10 Forward primer, pmol/µL 2.0
Reverse primer 10 pmol/µL 2.0 Tazyme 5U/µL 0.5 DNA template 0.3ug/µL ~ 6ug/µL 2.0 ddH2O-34.5 Note. This primer is a universal primer. Each PCR reaction must be blanked to confirm whether it is contaminated. Commercialized PCRPremix is available.
B. 3 PCR program of ITS2 gene the PCR reaction procedure of ITS2 gene is shown in Table B. 3.
SN/T 4876.7--2019 ????? ????, ????,?
Table B. 3 PCR program of ITS2 gene
Step reaction temperature (°C) Number of time cycles Pre-denaturing 94 5min-transsexual annealing extend 30s 30s 45s Extension 72 10min-Step reaction temperature (°C) Number of time cycles Pre-denaturing 94 5min-transsexual annealing extend 45s 1min 45s Extension 72 10min-SN/T 4876.7--2019 ????? ????, ????,?
Appendix C
(Informative appendix) Operation method of quarantine pest DNA barcode identification system in China the operation method of China's quarantine pest DNA barcode identification system is shown in Figure C. 1 ~ C. 2.
Figure C. 1 Species identification page
Figure C. 2 Identification results page
SN/T 4876.7--2019 ????? ????, ????,?
Appendix D
(Informative appendix) Gene barcode analysis software operation method Paste the query sequence in the "Enter aligned sequences" window. Click "Compare", the software will compare in the database range, and output the species identification results.
fruit. The corresponding classification order of the barcode sequence with the highest similarity in the result is the classification order to which the query sequence belongs. In "More Match Results", click Click "Start Comparison" to determine the species that meets the identification characteristics of this group and has a similarity of 100% as the unknown species.
"The result is shown in Figure D.1. The corresponding bar code sequence with the highest similarity is Euphorbia, with a similarity of 100%. Click" On "in this column.
The sequence is that species.
SN/T 4876.7--2019 ????? ????, ????,?
Appendix E
(Informative appendix) Sequence of common species of Poinsettia E. 1 Sequence information of common species of Poinsettia the sequence information of common species of Poinsettia is shown in Table E. 1.
E. 1 Sequence information of common species of Poinsettia SN/T 4876.7--2019 ????? ????, ????,?
......
This preview omits tables, figures, formulas and parts of the technical clauses. The complete document — 8 pages — is available in the English PDF.
Referenced standards
Normative references
How to Download SN/T 4876.7-2019
- 1
Add to cart
Click "Download PDF" on this page and choose "Buy this standard". You can add more standards before checkout.
- 2
Checkout
Enter your email and billing details. Payment is processed securely by Stripe (cards or bank transfer). Prefer bank details? Request a quotation (min. order $300).
- 3
Instant delivery (0–9 sec)
Delivery is automatic: within seconds of payment you'll receive an email with a secure download link. The link stays valid for 72 hours.
- 4
Invoice included
A tax invoice is attached to the confirmation email. Need a custom invoice? Contact us.
Related Standards
GB/T 3214-2007 — Methods for measurement of capacity of pump
GB/T 32140-2015 — Formula feed for soft-shelled turtle (Pelodiscus sinensis)
GB/T 32141-2015 — Determination of the total volatile basic nitrogen in feed
Secure payment via Stripe
Payments accepted
SN/T 4876.7-2019
$234.00